Approved Strains of Colletotrichum species
Several researchers published papers on re-classification of the genus Colletotrichum based on molecular phylogenetic studies during this century. They clarified that many conventional species of the genus defined by morphology consisted of plural phylogenetic species, with the establishment of new species and combinations. Many strains of the genus preserved in the NARO Genebank were re-identified based on partial sequences of so called barcode genes such as rDNA-ITS, β-tubulin-2 and Histone H3, and some of them with typical characters to each species were selected as the approved strains. Pending species and groups of the genus Colletotrichum are also examined and re-classified at present. More approved strains will be added according to the latest information.
- Reference Sato T., Moriwaki J. (2013). Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiol. Cult. Coll. 29(1): 13-23. [jsmrs.jp]
- Reference Sato T., Moriwaki J., Misawa T. (2013). Molecular re-identification of strains of the Colletotrichum acutatum species complex deposited in the NIAS Genebank and morphological characteristics of its member species. JARQ 47(3): 295-305. [10.6090/jarq.47.295]
| MAFF No. | Scientific Name*1 | Gene Regions*2 | Distribution |
|---|---|---|---|
| 305972 | Colletotrichum boninense | Actin CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 306162 | Colletotrichum boninense | Actin CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 238656 | Colletotrichum camelliae-japonicae (CBSC) | Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 239355 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239356 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239359 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239362 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239370 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239373 | Colletotrichum carthami (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 305429 | Colletotrichum cereale (CMSC) | HMG ITS SOD2 | Order |
| 510634 | Colletotrichum cereale (CMSC) | HMG ITS SOD2 | Order |
| 305748 | Colletotrichum chlorophyti | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 237304 | Colletotrichum circinans (CDSC) | Actin CHS-1 GPDH ITS β-tubulin | Order |
| 238028 | Colletotrichum circinans (CDSC) | Actin CHS-1 GPDH ITS | Order |
| 306100 | Colletotrichum cymbidiicola (CBSC) | Actin CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 238564 | Colletotrichum destructivum (CVSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 239947 | Colletotrichum destructivum (CVSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 511471 | Colletotrichum echinochloae (CMSC) | HMG ITS SOD2 | Order |
| 511472 | Colletotrichum echinochloae (CMSC) | HMG ITS SOD2 | Order |
| 511473 | Colletotrichum echinochloae (CMSC) | HMG ITS SOD2 | Order |
| 511155 | Colletotrichum eleusines (CMSC) | HMG ITS SOD2 | Order |
| 305077 | Colletotrichum falcatum (CMSC) | HMG ITS SOD2 | Order |
| 238654 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 241801 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 242591 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 306247 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 306504 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 306520 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 306527 | Colletotrichum fioriniae (CASC) | ITS β-tubulin | Order |
| 238783 | Colletotrichum gigasporum | Actin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin | Order |
| 237219 | Colletotrichum gloeosporioides (CGSC) | Actin CAL CHS-1 EF1-α GPDH GS ITS β-tubulin | Order |
| 306534 | Colletotrichum gloeosporioides (CGSC) | Actin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin | Order |
| 240289 | Colletotrichum godetiae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 241297 | Colletotrichum godetiae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 306506 | Colletotrichum godetiae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 511343 | Colletotrichum graminicola | HMG ITS SOD2 | Order |
| 305404 | Colletotrichum hanaui (CMSC) | HMG ITS SOD2 | Order |
| 511014 | Colletotrichum hanaui (CMSC) | HMG ITS SOD2 | Order |
| 238563 | Colletotrichum higginsianum (CVSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 305635 | Colletotrichum higginsianum (CVSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 243424 | Colletotrichum horii (CGSC) | Actin CAL CHS-1 GPDH ITS SOD2 β-tubulin | Order |
| 306429 | Colletotrichum horii (CGSC) | Actin CAL CHS-1 EF1-α GPDH ITS SOD2 β-tubulin | Order |
| 243051 | Colletotrichum hsienjenchang | Actin CHS-1 H3 ITS | Order |
| 237232 | Colletotrichum karsti (CBSC) | Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 305998 | Colletotrichum karsti (CBSC) | Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 306204 | Colletotrichum karsti (CBSC) | Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 840070 | Colletotrichum karsti (CBSC) | Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin | Order |
| 240431 | Colletotrichum lineola (CDSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 712313 | Colletotrichum lineola (CDSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 238703 | Colletotrichum liriopes (CSSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 242679 | Colletotrichum liriopes (CSSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 241800 | Colletotrichum metake | Actin CAL CHS-1 GPDH GS ITS SOD2 β-tubulin | Order |
| 510857 | Colletotrichum miscanthi (CMSC) | HMG ITS SOD2 | Order |
| 239086 | Colletotrichum musae (CGSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 305595 | Colletotrichum musae (CGSC) | Actin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin | Order |
| 305391 | Colletotrichum nicholsonii (CMSC) | HMG SOD2 | Order |
| 511115 | Colletotrichum nicholsonii (CMSC) | HMG SOD2 | Order |
| 241294 | Colletotrichum nymphaeae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 242590 | Colletotrichum nymphaeae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 306505 | Colletotrichum nymphaeae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 306523 | Colletotrichum nymphaeae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 712311 | Colletotrichum nymphaeae (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 306518 | Colletotrichum orbiculare | Actin EF1-α GPDH GS ITS β-tubulin | Order |
| 726522 | Colletotrichum orbiculare | Actin EF1-α GPDH GS ITS β-tubulin | Order |
| 305403 | Colletotrichum paspali (CMSC) | HMG ITS SOD2 | Order |
| 511000 | Colletotrichum paspali (CMSC) | HMG ITS SOD2 | Order |
| 239721 | Colletotrichum sansevieriae | Actin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin | Order |
| 242692 | Colletotrichum scovillei (CASC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 240106 | Colletotrichum shisoi | Actin EF1-α GPDH ITS β-tubulin | Order |
| 239736 | Colletotrichum sloanei (CASC) | Actin CAL CHS-1 GPDH GS H3 ITS β-tubulin | Order |
| 238702 | Colletotrichum spaethianum (CSSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 239500 | Colletotrichum spaethianum (CSSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 305360 | Colletotrichum sublineola (CMSC) | HMG ITS SOD2 | Order |
| 511474 | Colletotrichum sublineola (CMSC) | HMG ITS SOD2 | Order |
| 240195 | Colletotrichum tabacum (CVSC) | Actin EF1-α GPDH ITS β-tubulin | Order |
| 712333 | Colletotrichum tofieldiae (CSSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 237991 | Colletotrichum trichellum | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 410046 | Colletotrichum trichellum | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 305079 | Colletotrichum trifolii (COSC) | Actin EF1-α GPDH GS ITS β-tubulin | Order |
| 510896 | Colletotrichum trifolii (COSC) | Actin EF1-α GPDH GS ITS β-tubulin | Order |
| 239896 | Colletotrichum truncatum (CTSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 305754 | Colletotrichum truncatum (CTSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 306552 | Colletotrichum truncatum (CTSC) | Actin CHS-1 GPDH H3 ITS β-tubulin | Order |
| 238574 | Colletotrichum zoysiae | HMG ITS SOD2 | Order |
| 238575 | Colletotrichum zoysiae | HMG ITS SOD2 | Order |
- *1 Species complex:
(CASC): C. acutatum, (CBSC): C. boninense, (CDSC): C. dematium, (CGSC): C. gloeosporioides, (CMSC): C. graminicola, (COSC): C. orbiculare, (CSSC): C. spaethanum, (CTSC): C. truncatum, (CVSC): C. destructivum - *2 Primers are as follows:
Actin: ATGTGCAAGGCCGGTTTCGC / TACGAGTCCTTCTGGCCCAT
CAL: GAATTCAAGGAGGCCTTCTC / CTTCTGCATCATGAGCTGGAC
CHS-1: TGGGGCAAGGATGCTTGGAAGAAG / TGGAAGAACCATCTGTGAGAGTTG
EF1-α: TGCGTCATCGGCCACGT / GGATGTACCAGTSATCATGTT
GPDH: GCCGTCAACGACCCCTTCATTGA / GGGTGGAGTCGTACTTGAGCATGT
GS: GCCGGT GGAGGAACCGTCG / GAACCGTCGAAGTTCCAC
H3: AGGTCCACTGGTGGCAAG / AGCTGGATGTCCTTGGACTG
HMG: ATTCTCTACCGCAAGGATC / CAGTTTGT'TATGGCGCTC
ITS: GGAAGTAAAAGTCGTAACAAGG / TCCTCCGCTTATTGATATGC
SOD2: GCCCACAGTACATATTGCCTAAGC / TCATCCCGGGAGCCAGAAAACCT
β-tubulin: AACATGCGTGAGATTGTAAGT / ACCCTCAGTGTAGTGACCCTTGGC