Top > Databases > Approved strains
At the NIAS Genebank, approved strains for distribution are being selected based on the phylogenetic analyses of DNA sequences of some gene regions for their identification, as well as on the microscopic inspection of their cultural characteristics.
Approved Strains of Fusarium species
Recently molecular-phylogenetic studies on the species of the genus Fusarium and its allies based on comparative analyses of DNA sequences were much progressed. Many species within the genus were found to be species-complexes containing plural cryptic (hidden) species within their specific circumscription. Division of these species or their redefinition is also in progress. The NIAS Genebank has been performing DNA sequence analyses such as Histone H3 gene region, mitochondrion small-subunit ribosomal DNA (mtSSU rDNA), ribosomal DNA (rDNA) ITS regions (including partial sequences of 18S rDNA, ITS1, 5.8S rDNA, ITS2, partial sequences of 28S rDNA), as well as examining their cultural phenotypic characters. It was for the purpose to establish a set of typical Japanese strains of Fusarium species based on the current taxonomic basis. Typical strains which represent individual species were selected as “the Approved Strains for Distribution” of Fusarium species.
| MAFF No. | Scientific Name | Gene Regions |
|---|---|---|
| 240360 | Fusarium acuminatum | H3 ITS-L MtSSU |
| 240370 | Fusarium acuminatum | H3 ITS-L MtSSU |
| 240366 | Fusarium asiaticum | H3 ITS-L MtSSU |
| 240367 | Fusarium asiaticum | H3 ITS-L MtSSU |
| 240368 | Fusarium asiaticum | H3 ITS-L MtSSU |
| 240375 | Fusarium asiaticum | H3 ITS-L MtSSU |
| 240354 | Fusarium avenaceum | H3 ITS-L MtSSU |
| 240363 | Fusarium avenaceum | H3 ITS-L MtSSU |
| 240371 | Fusarium avenaceum | H3 ITS-L MtSSU |
| 240376 | Fusarium avenaceum | H3 ITS-L MtSSU |
| 101144 | Fusarium cerealis | H3 ITS-L MtSSU |
| 236397 | Fusarium circinatum | H3 ITS-L MtSSU |
| 237714 | Fusarium coccophilum | H3 ITS-L MtSSU |
| 237881 | Fusarium coccophilum | H3 ITS-L MtSSU |
| 235976 | Fusarium coeruleum | H3 ITS-L MtSSU |
| 235977 | Fusarium coeruleum | H3 ITS-L MtSSU |
| 237650 | Fusarium concentricum | H3 ITS-L MtSSU |
| 236454 | Fusarium culmorum | H3 ITS-L MtSSU |
| 305607 | Fusarium cuneirostrum | H3 ITS-L MtSSU |
| 238422 | Fusarium decemcellulare | H3 ITS-L MtSSU |
| 238423 | Fusarium decemcellulare | H3 ITS-L MtSSU |
| 238424 | Fusarium decemcellulare | H3 ITS-L MtSSU |
| 240179 | Fusarium foetens | H3 ITS-L MtSSU |
| 240180 | Fusarium foetens | H3 ITS-L MtSSU |
| 237530 | Fusarium fractiflexum | H3 ITS-L MtSSU |
| 238531 | Fusarium fujikuroi | H3 ITS-L MtSSU |
| 237511 | Fusarium globosum | H3 ITS-L MtSSU |
| 240353 | Fusarium graminearum | H3 ITS-L MtSSU |
| 240365 | Fusarium graminearum | H3 ITS-L MtSSU |
| 236532 | Fusarium incarnatum | H3 ITS-L MtSSU |
| 240355 | Fusarium incarnatum | H3 ITS-L MtSSU |
| 240364 | Fusarium incarnatum | H3 ITS-L MtSSU |
| 240372 | Fusarium kyushuense | H3 ITS-L MtSSU |
| 840045 | Fusarium lateritium f. mori | H3 ITS-L MtSSU |
| 238439 | Fusarium matuoi | H3 ITS-L MtSSU |
| 410883 | Fusarium matuoi | H3 ITS-L MtSSU |
| 236504 | Fusarium merismoides | H3 ITS-L MtSSU |
| 237507 | Fusarium nisikadoi | H3 ITS-L MtSSU |
| 239069 | Fusarium nygamai | H3 ITS-L MtSSU |
| 410171 | Fusarium oxysporum | H3 ITS-L MtSSU |
| 410172 | Fusarium oxysporum | H3 ITS-L MtSSU |
| 237465 | Fusarium penzigii | H3 ITS-L MtSSU |
| 240357 | Fusarium poae | H3 ITS-L MtSSU |
| 240374 | Fusarium poae | H3 ITS-L MtSSU |
| 410715 | Fusarium proliferatum | H3 ITS-L MtSSU |
| 410716 | Fusarium proliferatum | H3 ITS-L MtSSU |
| 306334 | Fusarium redolens | H3 ITS-L MtSSU |
| 306335 | Fusarium redolens | H3 ITS-L MtSSU |
| 306336 | Fusarium redolens | H3 ITS-L MtSSU |
| 306337 | Fusarium redolens | H3 ITS-L MtSSU |
| 239074 | Fusarium sacchari | H3 ITS-L MtSSU |
| 238542 | Fusarium solani f. robiniae | H3 ITS-L MtSSU |
| 238541 | Fusarium solani f. xanthoxyli | H3 ITS-L MtSSU |
| 238538 | Fusarium solani f. sp. mori | H3 ITS-L MtSSU |
| 840046 | Fusarium solani f. sp. mori | H3 ITS-L MtSSU |
| 840047 | Fusarium solani f. sp. pisi | H3 ITS-L MtSSU |
| 240356 | Fusarium sporotrichioides | H3 ITS-L MtSSU |
| 240373 | Fusarium sporotrichioides | H3 ITS-L MtSSU |
| 241719 | Fusarium thapsinum | 18S D1/D2 H3 ITS-L MtSSU |
| 241721 | Fusarium thapsinum | H3 ITS-L MtSSU |
| 241722 | Fusarium thapsinum | H3 ITS-L MtSSU |
| 240358 | Fusarium tricinctum | H3 ITS-L MtSSU |
| 240087 | Fusarium verticillioides | H3 ITS-L MtSSU |
| 240093 | Fusarium verticillioides | H3 ITS-L MtSSU |
| 240095 | Fusarium verticillioides | H3 ITS-L MtSSU |
| 241221 | Fusarium vorosii | H3 ITS-L MtSSU |
| 241222 | Fusarium vorosii | H3 ITS-L MtSSU |
| 238974 | Haematonectria ipomoeae | H3 ITS-L MtSSU |
| 240020 | Haematonectria ipomoeae | H3 ITS-L MtSSU |
- *1 Lower case letters at the beginning and the end of the DNA sequences indicate the primer sequences used for the DNA amplification by PCR.
- *2 ITS-L indicates DNA sequences of 18S rDNA (partial), ITS1, 5.8S rDNA, ITS2, 28S rDNA (partial).
Approved Strains of Colletotrichum species
Several researchers published papers on re-classification of the genus Colletotrichum based on molecular phylogenetic studies during this century. They clarified that many conventional species of the genus defined by morphology consisted of plural phylogenetic species, with the establishment of new species and combinations. Many strains of the genus preserved in the NIAS Genebank were re-identified based on partial sequences of so called barcode genes such as rDNA-ITS, β-tubulin-2 and Histone H3, and some of them with typical characters to each species were selected as the approved strains. Pending species and groups of the genus Colletotrichum are also examined and re-classified at present. More approved strains will be added according to the latest information.
| MAFF No. | Scientific Name | Gene Regions |
|---|---|---|
| 744062 | Colletotrichum acutatum sensu lato | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 239355 | Colletotrichum carthami | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 239359 | Colletotrichum carthami | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 238574 | Colletotrichum caudatum | HMG ITS SOD2 |
| 238575 | Colletotrichum caudatum | HMG ITS SOD2 |
| 305700 | Colletotrichum caudatum | HMG ITS SOD2 |
| 305429 | Colletotrichum cereale | HMG ITS SOD2 |
| 510634 | Colletotrichum cereale | HMG ITS SOD2 |
| 511471 | Colletotrichum echinochloae | HMG ITS SOD2 |
| 511472 | Colletotrichum echinochloae | HMG ITS SOD2 |
| 511473 | Colletotrichum echinochloae | HMG ITS SOD2 |
| 511155 | Colletotrichum eleusines | HMG ITS SOD2 |
| 305077 | Colletotrichum falcatum | HMG ITS SOD2 |
| 238654 | Colletotrichum fioriniae | ITS β-tubulin |
| 241801 | Colletotrichum fioriniae | ITS β-tubulin |
| 241878 | Colletotrichum fioriniae | ITS β-tubulin |
| 242591 | Colletotrichum fioriniae | ITS β-tubulin |
| 306247 | Colletotrichum fioriniae | ITS β-tubulin |
| 306283 | Colletotrichum fioriniae | ITS β-tubulin |
| 306504 | Colletotrichum fioriniae | ITS β-tubulin |
| 306520 | Colletotrichum fioriniae | ITS β-tubulin |
| 306527 | Colletotrichum fioriniae | ITS β-tubulin |
| 306549 | Colletotrichum fioriniae | ITS β-tubulin |
| 306551 | Colletotrichum fioriniae | ITS β-tubulin |
| 712312 | Colletotrichum fioriniae | ITS β-tubulin |
| 240289 | Colletotrichum godetiae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 241297 | Colletotrichum godetiae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 306506 | Colletotrichum godetiae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 511343 | Colletotrichum graminicola | HMG ITS SOD2 |
| 305404 | Colletotrichum hanaui | HMG ITS SOD2 |
| 511014 | Colletotrichum hanaui | HMG ITS SOD2 |
| 510857 | Colletotrichum miscanthi | HMG ITS SOD2 |
| 241294 | Colletotrichum nymphaeae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 242590 | Colletotrichum nymphaeae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 306505 | Colletotrichum nymphaeae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 306523 | Colletotrichum nymphaeae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 712311 | Colletotrichum nymphaeae | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 305403 | Colletotrichum paspali | HMG ITS SOD2 |
| 511000 | Colletotrichum paspali | HMG ITS SOD2 |
| 242692 | Colletotrichum scovillei | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 239736 | Colletotrichum sloanei | Actin CHS-1 GPDH H3 ITS β-tubulin |
| 305360 | Colletotrichum sublineola | HMG ITS SOD2 |
| 511474 | Colletotrichum sublineola | HMG ITS SOD2 |
- *1 Primers are as follows:
- Actin: ATGTGCAAGGCCGGTTTCGC / TACGAGTCCTTCTGGCCCAT
- CHS-1: TGGGGCAAGGATGCTTGGAAGAAG / TGGAAGAACCATCTGTGAGAGTTG
- GPDH: GCCGTCAACGACCCCTTCATTGA / GGGTGGAGTCGTACTTGAGCATGT
- H3: AGGTCCACTGGTGGCAAG / AGCTGGATGTCCTTGGACTG
- HMG: ATTCTCTACCGCAAGGATC / CAGTTTGT'TATGGCGCTC
- ITS: GGAAGTAAAAGTCGTAACAAGG / TCCTCCGCTTATTGATATGC
- SOD2: GCCCACAGTACATATTGCCTAAGC / TCATCCCGGGAGCCAGAAAACCT
- β-tubulin: AACATGCGTGAGATTGTAAGT / ACCCTCAGTGTAGTGACCCTTGGC