Top > Databases > Approved strains

At the NIAS Genebank, approved strains for distribution are being selected based on the phylogenetic analyses of DNA sequences of some gene regions for their identification, as well as on the microscopic inspection of their cultural characteristics.

Approved Strains of Fusarium species

Recently molecular-phylogenetic studies on the species of the genus Fusarium and its allies based on comparative analyses of DNA sequences were much progressed. Many species within the genus were found to be species-complexes containing plural cryptic (hidden) species within their specific circumscription. Division of these species or their redefinition is also in progress. The NIAS Genebank has been performing DNA sequence analyses such as Histone H3 gene region, mitochondrion small-subunit ribosomal DNA (mtSSU rDNA), ribosomal DNA (rDNA) ITS regions (including partial sequences of 18S rDNA, ITS1, 5.8S rDNA, ITS2, partial sequences of 28S rDNA), as well as examining their cultural phenotypic characters. It was for the purpose to establish a set of typical Japanese strains of Fusarium species based on the current taxonomic basis. Typical strains which represent individual species were selected as “the Approved Strains for Distribution” of Fusarium species.

Approved Strains of Fusarium species
MAFF No.Scientific NameGene Regions
240360Fusarium acuminatumH3 ITS-L MtSSU
240370Fusarium acuminatumH3 ITS-L MtSSU
240366Fusarium asiaticumH3 ITS-L MtSSU
240367Fusarium asiaticumH3 ITS-L MtSSU
240368Fusarium asiaticumH3 ITS-L MtSSU
240375Fusarium asiaticumH3 ITS-L MtSSU
240354Fusarium avenaceumH3 ITS-L MtSSU
240363Fusarium avenaceumH3 ITS-L MtSSU
240371Fusarium avenaceumH3 ITS-L MtSSU
240376Fusarium avenaceumH3 ITS-L MtSSU
101144Fusarium cerealisH3 ITS-L MtSSU
236397Fusarium circinatumH3 ITS-L MtSSU
237714Fusarium coccophilumH3 ITS-L MtSSU
237881Fusarium coccophilumH3 ITS-L MtSSU
235976Fusarium coeruleumH3 ITS-L MtSSU
235977Fusarium coeruleumH3 ITS-L MtSSU
237650Fusarium concentricumH3 ITS-L MtSSU
236454Fusarium culmorumH3 ITS-L MtSSU
305607Fusarium cuneirostrumH3 ITS-L MtSSU
238422Fusarium decemcellulareH3 ITS-L MtSSU
238423Fusarium decemcellulareH3 ITS-L MtSSU
238424Fusarium decemcellulareH3 ITS-L MtSSU
240179Fusarium foetensH3 ITS-L MtSSU
240180Fusarium foetensH3 ITS-L MtSSU
237530Fusarium fractiflexumH3 ITS-L MtSSU
238531Fusarium fujikuroiH3 ITS-L MtSSU
237511Fusarium globosumH3 ITS-L MtSSU
240353Fusarium graminearumH3 ITS-L MtSSU
240365Fusarium graminearumH3 ITS-L MtSSU
236532Fusarium incarnatumH3 ITS-L MtSSU
240355Fusarium incarnatumH3 ITS-L MtSSU
240364Fusarium incarnatumH3 ITS-L MtSSU
240372Fusarium kyushuenseH3 ITS-L MtSSU
840045Fusarium lateritium f. moriH3 ITS-L MtSSU
238439Fusarium matuoiH3 ITS-L MtSSU
410883Fusarium matuoiH3 ITS-L MtSSU
236504Fusarium merismoidesH3 ITS-L MtSSU
237507Fusarium nisikadoiH3 ITS-L MtSSU
239069Fusarium nygamaiH3 ITS-L MtSSU
410171Fusarium oxysporumH3 ITS-L MtSSU
410172Fusarium oxysporumH3 ITS-L MtSSU
237465Fusarium penzigiiH3 ITS-L MtSSU
240357Fusarium poaeH3 ITS-L MtSSU
240374Fusarium poaeH3 ITS-L MtSSU
410715Fusarium proliferatumH3 ITS-L MtSSU
410716Fusarium proliferatumH3 ITS-L MtSSU
306334Fusarium redolensH3 ITS-L MtSSU
306335Fusarium redolensH3 ITS-L MtSSU
306336Fusarium redolensH3 ITS-L MtSSU
306337Fusarium redolensH3 ITS-L MtSSU
239074Fusarium sacchariH3 ITS-L MtSSU
238542Fusarium solani f. robiniaeH3 ITS-L MtSSU
238541Fusarium solani f. xanthoxyliH3 ITS-L MtSSU
238538Fusarium solani f. sp. moriH3 ITS-L MtSSU
840046Fusarium solani f. sp. moriH3 ITS-L MtSSU
840047Fusarium solani f. sp. pisiH3 ITS-L MtSSU
240356Fusarium sporotrichioidesH3 ITS-L MtSSU
240373Fusarium sporotrichioidesH3 ITS-L MtSSU
241719Fusarium thapsinum18S D1/D2 H3 ITS-L MtSSU
241721Fusarium thapsinumH3 ITS-L MtSSU
241722Fusarium thapsinumH3 ITS-L MtSSU
240358Fusarium tricinctumH3 ITS-L MtSSU
240087Fusarium verticillioidesH3 ITS-L MtSSU
240093Fusarium verticillioidesH3 ITS-L MtSSU
240095Fusarium verticillioidesH3 ITS-L MtSSU
241221Fusarium vorosiiH3 ITS-L MtSSU
241222Fusarium vorosiiH3 ITS-L MtSSU
238974Haematonectria ipomoeaeH3 ITS-L MtSSU
240020Haematonectria ipomoeaeH3 ITS-L MtSSU
  • *1 Lower case letters at the beginning and the end of the DNA sequences indicate the primer sequences used for the DNA amplification by PCR.
  • *2 ITS-L indicates DNA sequences of 18S rDNA (partial), ITS1, 5.8S rDNA, ITS2, 28S rDNA (partial).

Approved Strains of Colletotrichum species

Several researchers published papers on re-classification of the genus Colletotrichum based on molecular phylogenetic studies during this century. They clarified that many conventional species of the genus defined by morphology consisted of plural phylogenetic species, with the establishment of new species and combinations. Many strains of the genus preserved in the NIAS Genebank were re-identified based on partial sequences of so called barcode genes such as rDNA-ITS, β-tubulin-2 and Histone H3, and some of them with typical characters to each species were selected as the approved strains. Pending species and groups of the genus Colletotrichum are also examined and re-classified at present. More approved strains will be added according to the latest information.

Literatures:
Sato T, Moriwaki J (2013) Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiol Culture Collect 29: 13-23
Sato T, Moriwaki J, Misawa T (2013) Molecular re-identification of strains of the Colletotrichum acutatum species complex deposited in the NIAS Genebank and morphological characteristics of its member species. JARQ 47: 295-305
Approved Strains of Colletotrichum species
MAFF No.Scientific Name*1Gene Regions*2
744062Colletotrichum acutatum sensu latoActin CHS-1 GPDH H3 ITS β-tubulin
305972Colletotrichum boninenseActin CHS-1 EF1-α GPDH H3 ITS β-tubulin
306162Colletotrichum boninenseActin CHS-1 EF1-α GPDH H3 ITS β-tubulin
239355Colletotrichum carthami (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239359Colletotrichum carthami (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
238574Colletotrichum caudatumHMG ITS SOD2
238575Colletotrichum caudatumHMG ITS SOD2
305700Colletotrichum caudatumHMG ITS SOD2
305429Colletotrichum cereale (CMSC)HMG ITS SOD2
510634Colletotrichum cereale (CMSC)HMG ITS SOD2
305748Colletotrichum chlorophyti (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
239356Colletotrichum chrysanthemi (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239362Colletotrichum chrysanthemi (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239368Colletotrichum chrysanthemi (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239370Colletotrichum chrysanthemi (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239373Colletotrichum chrysanthemi (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
237304Colletotrichum circinans (CDSC)Actin CHS-1 GPDH ITS β-tubulin
238028Colletotrichum circinans (CDSC)Actin CHS-1 GPDH ITS
306100Colletotrichum cymbidiicola (CBSC)Actin CHS-1 EF1-α GPDH H3 ITS β-tubulin
511471Colletotrichum echinochloae (CMSC)HMG ITS SOD2
511472Colletotrichum echinochloae (CMSC)HMG ITS SOD2
511473Colletotrichum echinochloae (CMSC)HMG ITS SOD2
511155Colletotrichum eleusines (CMSC)HMG ITS SOD2
305077Colletotrichum falcatum (CMSC)HMG ITS SOD2
238654Colletotrichum fioriniae (CASC)ITS β-tubulin
241801Colletotrichum fioriniae (CASC)ITS β-tubulin
242591Colletotrichum fioriniae (CASC)ITS β-tubulin
306247Colletotrichum fioriniae (CASC)ITS β-tubulin
306283Colletotrichum fioriniae (CASC)ITS β-tubulin
306504Colletotrichum fioriniae (CASC)ITS β-tubulin
306520Colletotrichum fioriniae (CASC)ITS β-tubulin
306527Colletotrichum fioriniae (CASC)ITS β-tubulin
240289Colletotrichum godetiae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
241297Colletotrichum godetiae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
306506Colletotrichum godetiae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
511343Colletotrichum graminicolaHMG ITS SOD2
305404Colletotrichum hanaui (CMSC)HMG ITS SOD2
511014Colletotrichum hanaui (CMSC)HMG ITS SOD2
243424Colletotrichum horii (CGSC)Actin CAL CHS-1 GPDH ITS SOD2 β-tubulin
306429Colletotrichum horii (CGSC)Actin CAL CHS-1 EF1-α GPDH ITS SOD2 β-tubulin
243051Colletotrichum hsienjenchangActin CHS-1 H3 ITS
237232Colletotrichum karstii (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
305973Colletotrichum karstii (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
305998Colletotrichum karstii (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
306204Colletotrichum karstii (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
840070Colletotrichum karstii (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
240431Colletotrichum lineola (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
712313Colletotrichum lineola (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
238703Colletotrichum liriopes (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
242679Colletotrichum liriopes (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
241800Colletotrichum metakeActin CAL CHS-1 GPDH ITS SOD2 β-tubulin
510857Colletotrichum miscanthi (CMSC)HMG ITS SOD2
239086Colletotrichum musae (CGSC)Actin EF1-α GPDH ITS β-tubulin
305595Colletotrichum musae (CGSC)Actin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin
305391Colletotrichum nicholsonii (CMSC)HMG SOD2
511115Colletotrichum nicholsonii (CMSC)HMG SOD2
241294Colletotrichum nymphaeae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
242590Colletotrichum nymphaeae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
306505Colletotrichum nymphaeae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
306523Colletotrichum nymphaeae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
712311Colletotrichum nymphaeae (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
305403Colletotrichum paspali (CMSC)HMG ITS SOD2
511000Colletotrichum paspali (CMSC)HMG ITS SOD2
238656Colletotrichum phyllanthi (CBSC)Actin CAL CHS-1 EF1-α GPDH H3 ITS β-tubulin
239721Colletotrichum sansevieriaeActin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin
242692Colletotrichum scovillei (CASC)Actin CHS-1 GPDH H3 ITS β-tubulin
239736Colletotrichum sloanei (CGSC)Actin CHS-1 GPDH H3 ITS β-tubulin
238702Colletotrichum spaethianum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
239500Colletotrichum spaethianum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
305360Colletotrichum sublineola (CMSC)HMG ITS SOD2
511474Colletotrichum sublineola (CMSC)HMG ITS SOD2
238783Colletotrichum taiwanenseActin CAL CHS-1 EF1-α GPDH GS ITS SOD2 β-tubulin
712333Colletotrichum tofieldiae (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
712334Colletotrichum tofieldiae (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
237991Colletotrichum trichellum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
410046Colletotrichum trichellum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
239896Colletotrichum truncatum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
305754Colletotrichum truncatum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
306552Colletotrichum truncatum (CDSC)Actin CHS-1 GPDH H3 ITS β-tubulin
  • *1 Species complex:
    • (CASC): C. acutatum, (CBSC): C. boninense, (CDSC): C. dematium, (CGSC): C. gloeosporioides, (CMSC): C. graminicola
  • *2 Primers are as follows:
    • Actin: ATGTGCAAGGCCGGTTTCGC / TACGAGTCCTTCTGGCCCAT
    • CAL: GAATTCAAGGAGGCCTTCTC / CTTCTGCATCATGAGCTGGAC
    • CHS-1: TGGGGCAAGGATGCTTGGAAGAAG / TGGAAGAACCATCTGTGAGAGTTG
    • GPDH: GCCGTCAACGACCCCTTCATTGA / GGGTGGAGTCGTACTTGAGCATGT
    • GS: GCCGGT GGAGGAACCGTCG / GAACCGTCGAAGTTCCAC
    • H3: AGGTCCACTGGTGGCAAG / AGCTGGATGTCCTTGGACTG
    • HMG: ATTCTCTACCGCAAGGATC / CAGTTTGT'TATGGCGCTC
    • ITS: GGAAGTAAAAGTCGTAACAAGG / TCCTCCGCTTATTGATATGC
    • SOD2: GCCCACAGTACATATTGCCTAAGC / TCATCCCGGGAGCCAGAAAACCT
    • β-tubulin: AACATGCGTGAGATTGTAAGT / ACCCTCAGTGTAGTGACCCTTGGC

Approved strains of phytopathogenic Rhizobium species (formerly Agrobacterium species)

In the case of the genus Agrobacterium, which comprises crown gall bacteria and hairy root bacteria, the genus and species have been artificially defined based on pathogenic characters. For some species of the genus, several biovars, equivalent to the rank of variety level, have been established. Recently, based on the results of polyphasic taxonomic approaches, it was proposed that each biovar should be elevated to the species level (Sawada et al., 1993; Ophel and Kerr, 1990), and that the genera Agrobacterium and Rhizobium should be amalgamated into one single genus Rhizobium (Young et al., 2001). Taking these changes in the taxonomic situation into consideration, strains belonging to the phytopathogenic Rhizobium species (formerly Agrobacterium species) preserved in the NIAS Genebank were re-identified based on phylogenetic analyses using 16S rDNA, atpD, glnA and recA, inoculation tests, PCR assays and so on, and some of them with typical characters for each species/pathogenic state/genomovar were selected as the approved strains (reference strains for taxonomic studies). In addition, for every host plant, we chose pathogenic strains that were proved to harbor Ti or Ri plasmids, as the approved strains (reference strains for inoculation tests).

Literatures:
Young JM, Kuykendall LD, Martinez-Romero E, Kerr A, Sawada H (2001). A revision of Rhizobium Frank 1889, with an emended description of the genus, and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. 1998 as new combinations: Rhizobium radiobacter, R. rhizogenes, R. rubi, R. undicola and R. vitis. Int. J. Syst. Evol. Microbiol. 51: 89-103.
Sawada H, Ieki H, Oyaizu H, Matsumoto S (1993). Proposal for rejection of Agrobacterium tumefaciens and revised descriptions for the genus Agrobacterium and for Agrobacterium radiobacter and Agrobacterium rhizogenes. Int. J. Syst. Bacteriol. 43: 694-702.
Ophel K, Kerr A (1990). Agrobacterium vitis sp. nov. for strains of Agrobacterium biovar 3 from grapevines. Int. J. Syst. Bacteriol. 40: 236-241.
Approved strains of phytopathogenic Rhizobium species (reference strains for taxonomic studies)
MAFF No.Scientific Name (Pathogenic State)GenomovarGene Regions
301276Rhizobium radiobacter (Ti)G116S atpD glnA recA
301224Rhizobium radiobacter (Ti)G116S atpD glnA recA
301001Rhizobium radiobacter (Ti)G416S atpD glnA recA
211863Rhizobium radiobacter (Ti)G416S atpD glnA recA
302378Rhizobium radiobacter (Ti)G816S atpD glnA recA
212033Rhizobium radiobacter (Ri)G716S atpD glnA recA
301724Rhizobium radiobacter (Ri)G716S atpD glnA recA
212029Rhizobium radiobacter (Ri)G916S atpD glnA recA
210265Rhizobium radiobacter (Ri)G916S atpD glnA recA
311303Rhizobium radiobacter (nonpathogenic)G116S atpD glnA recA
520014Rhizobium radiobacter (nonpathogenic)G916S atpD glnA recA
211729Rhizobium rhizogenes (Ti)16S atpD glnA recA
211728Rhizobium rhizogenes (Ti)16S atpD glnA recA
663001Rhizobium vitis (Ti)16S atpD glnA recA
663007Rhizobium vitis (Ti)16S atpD glnA recA
211942Rhizobium vitis (Ti)16S glnA recA
211908Rhizobium vitis (Ti)16S atpD glnA recA
  • *1 Typical strains that represent individual species/pathogenic state/genomovars, were selected as the approved strains, and listed with relevant information.
  • *2 Genomovars are ranked equivalent to variety level in R. radiobacter.
Approved strains of phytopathogenic Rhizobium species (reference strains for inoculation tests)
MAFF No.Scientific Name (Pathogenic State)Host PlantGene Regions
211866Rhizobium radiobacter (Ti)Apple16S atpD glnA recA
211865Rhizobium rhizogenes (Ti)Apple16S atpD glnA recA
302556Rhizobium radiobacter (Ti)Aster16S atpD glnA recA
302563Rhizobium rhizogenes (Ti)Baby's breath16S atpD glnA recA
301001Rhizobium radiobacter (Ti)Cherry (Sakura)16S atpD glnA recA
211736Rhizobium rhizogenes (Ti)Cherry (Sakura)16S atpD glnA recA
302338Rhizobium radiobacter (Ti)China aster16S atpD glnA recA
302558Rhizobium radiobacter (Ti)Common cosmos16S atpD glnA recA
301276Rhizobium radiobacter (Ti)Florist chrysanthemum16S atpD glnA recA
302378Rhizobium radiobacter (Ti)Florist chrysanthemum16S atpD glnA recA
211728Rhizobium rhizogenes (Ti)Japanese pear, Sand pear16S atpD glnA recA
663002Rhizobium rhizogenes (Ti)Japanese pear, Sand pear16S atpD glnA recA
211729Rhizobium rhizogenes (Ti)Japanese plum16S atpD glnA recA
211730Rhizobium rhizogenes (Ti)Japanese plum16S atpD glnA recA
211950Rhizobium vitis (Ti)Kiwi fruit, Chinese gooseberry16S atpD glnA recA
211951Rhizobium vitis (Ti)Kiwi fruit, Chinese gooseberry16S atpD glnA recA
301222Rhizobium radiobacter (Ti)Marguerite16S atpD glnA recA
663003Rhizobium rhizogenes (Ti)Peach16S atpD glnA recA
211710Rhizobium rhizogenes (Ti)Peach16S atpD glnA recA
301224Rhizobium radiobacter (Ti)Rose16S atpD glnA recA
663018Rhizobium rhizogenes (Ti)Rose16S atpD glnA recA
211706Rhizobium rhizogenes (Ti)Rose16S atpD glnA recA
211872Rhizobium radiobacter (Ti)Solidago16S atpD glnA recA
211863Rhizobium radiobacter (Ti)Sweet cherry16S atpD glnA recA
211731Rhizobium rhizogenes (Ti)Sweet cherry16S atpD glnA recA
211735Rhizobium rhizogenes (Ti)Sweet cherry16S atpD glnA recA
663001Rhizobium vitis (Ti)Vitis16S atpD glnA recA
663007Rhizobium vitis (Ti)Vitis16S atpD glnA recA
301724Rhizobium radiobacter (Ri)Melon16S atpD glnA recA
210265Rhizobium radiobacter (Ri)Melon16S atpD glnA recA
212029Rhizobium radiobacter (Ri)Tomato16S atpD glnA recA
212033Rhizobium radiobacter (Ri)Tomato16S atpD glnA recA
  • *1 For every host plant, pathogenic strains that were proved to harbor Ti or Ri plasmids, were selected as the approved strains, and listed with relevant information.
  • *2 In cases where R. radiobacter (Ti) and R. rhizogenes (Ti) were both obtained from one host plant, approved strains were selected from each of the species.